 |
||||||||||||||||||||||||||||||||||||||
| pEGAD expression vector | ||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
| The cDNA library was cloned into pEGAD using a directional HIndII-EcoR1 linker. The two terminal HindII sites are partial sites, a complete HindII site is created only if two T's are added by primer design to one end of the DNA sequence to be cloned. When amplfied with methyl-dCTP, internal EcoR1 and HindII sites in the cloned DNA are protected from cleavage: | ||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||
| The EcoRI site is in frame with the EGFP coding frame. The linker adds 4 amino acids between the Ala10 protein linker encoded in pEGAD and the peptide encoded by the cloned sequence. The first three amino acids are invariant and are encoded by the first 9 bases in the linker. The fourth amino acid is variable as it is encoded by the last base of the linker and the first two bases of the inserted sequence: | ||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||
| The cDNA inserts can usually be amplified and recloned using the following primers: | ||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
| A5A CTCGGCATGGACGAGCTG
EGAD TCCTCGAGATCAGTTATCTAG |
||||||||||||||||||||||||||||||||||||||
| Complete sequence | ||||||||||||||||||||||||||||||||||||||
| Details of construction | ||||||||||||||||||||||||||||||||||||||
 |
||||||||||||||||||||||||||||||||||||||
|
||||||||||||||||||||||||||||||||||||||
